Transient transfection miR-125b-inhibitor (5′-UCACAAGUUAGGGUCUCAGGGA-3′) and nonspecific control miRNA (NC, 5′-CAGUACUUUUGUGUAGUACAA-3′) were

designed based on miRbase Database (http://​www.​miRbase.​org) and synthesized by Genepharma (Shanghai, China). Cells were seeded (1.6×104/well) onto 96-well plate 18–20 h before transfection. Anti-miR-125b or NC was added to each well. After 6 h incubation at 37°C check details and 5% CO2, the medium was replaced with fresh culture medium. The cells were harvested at 48 h post transfection. Establishment of stable cell line Cells were transfected with 3 μg of plasmids (pLVTHM-MTA1-si, or pLVTHM-CTL-si) which were constructed in previous study [6], or empty pLVTHM vector using Lipofectamine2000 (Invitrogen, Carlsbad, CA) according to the manufacturer’s protocol, then selected for the resistant to neomycin. The stable resistant cell lines were selected

and named as 95D (or SPC-A-1)/MTA1-si, 95D (or SPC-A-1)/ CTL-si, and 95D (or SPC-A-1)/NC, respectively. Quantitative real-time PCR Total RNA was extracted from the cells with Trizol reagent (Invitrogen) following the manufacturer’s instruction. Quantitative real-time PCR for miR-125b or MTA1 mRNA was performed as described previously [6]. For miR-125b quantification, U6 small nuclear RNA (U6 snRNA) was used as internal control. The primers sequences were as follows: hsa-miR-125b forward: GGCAACCTTGCGACTATAACCA,

those reverse: GTTTCCTCTCCCTGAGACCCTA; U6 snRNA forward: CTCGCTTCGGCAGCACATATACT, Selleck LY2874455 reverse ACGCTTCACGAATTTGCGTGTC. The relative quantification of expression levels was calculated using the 2−ΔΔCt method. Western blot analysis Total protein was extracted from the cells using RIPA kit (Pierce, USA). Protein concentrations of the supernatants were determined using BCA method. Equal amounts of proteins were separated by SDS-PAGE and transferred into nitrocellulose membranes, which were incubated with primary antibodies against MTA1 (1:1500; Abcam, Cambridge, MA, USA) and β-Actin (1:1000; Santa Cruz Biotech, Santa Cruz, CA, USA) at 4°C overnight. The membranes were washed three times with TBST and incubated with peroxidase conjugated goat anti-rabbit IgG secondary antibody (1:1000, Santa Cruz Biotech, Santa Cruz, CA, USA) for 1 h at room temperature. Finally, the membranes were washed three times with TBST and visualized using Western Blotting GSK461364 supplier Luminol Reagent (Santa Cruz Biotech, Santa Cruz, CA, USA) according to the manufacturer’s instruction. Wound healing assay Cells were seeded into six-well plate and grown to confluence. Wound was created by scraping confluent cell monolayers with a pipette tip. The cells were allowed to migrate for 48 h. At 0 h and 48 h after scratching, images were taken under the inverted microscope to assess the ability of the cells to migrate into the wound area.

haemolyticum pathogenesis. Acknowledgements The authors thank Petteri Carlson, see more University of Helsinki for providing the A. haemolyticum isolates, and Maricela V. Pier and Andrew E. Clark, University of Arizona for technical assistance. Support for this work was provided by USDA Hatch ARZT-136828-H-02-129, the College of Agriculture and Life Sciences, University of Arizona to BHJ, National Institutes of Health R01-AI092743 to AJR, and start-up funds from LSU Health Sciences Center-Shreveport to DJM. References 1. Linder R: Rhodococcus equi and Arcanobacterium haemolyticum : two “”coryneform”" bacteria increasingly recognized

as agents of human infection. Emerging Infectious Diseases 1997, 3:145–153.PubMedCrossRef Tanespimycin 2. Banck G, Nyman M: Tonsillitis and rash associated with Corynebacterium

haemolyticum . J Infect Dis 1986, 154:1037–1040.PubMedCrossRef 3. Mackenzie A, Fuite LA, Chan FT, King J, Allen U, MacDonald N, Diaz-Mitoma F: Incidence and pathogenicity of Arcanobacterium haemolyticum during a 2-year study in Ottawa. Clin Infect Dis 1995, 21:177–181.PubMedCrossRef 4. Miller RA, Brancato F, Holmes KK: Corynebacterium haemolyticum as a cause of pharyngitis and scarlatiniform rash in young adults. Ann Intern Med 1986, www.selleckchem.com/products/birinapant-tl32711.html 105:867–872.PubMed 5. Collins MD, Jones D, Schofield GM: Reclassification of ‘ Corynebacterium haemolyticum ‘ (MacLean, Liebow & Rosenberg) in the genus Arcanobacterium gen. nov. as Arcanobacterium haemolyticum nom. rev., comb. nov. J Gen Microbiol 1982, 128:1279–1281.PubMed 6. Jost BH, Billington SJ: Arcanobacterium pyogenes : molecular pathogenesis of an animal opportunist. Antonie van Leeuwenhoek 2005, 88:87–102.PubMedCrossRef 7. Cuevas WA, Songer JG: Arcanobacterium haemolyticum phospholipase D is genetically and functionally similar to Corynebacterium pseudotuberculosis phospholipase D. Infect Immun 1993, 61:4310–4316.PubMed 8. Soucek A, Souckova A: Toxicity of bacterial sphingomyelinases D. J Hyg Epidemiol Microbiol

Immunol 1974, 18:327–335.PubMed 9. Lucas EA, Billington SJ, Carlson P, McGee DJ, Jost BH: Phospholipase D promotes Arcanobacterium haemolyticum adhesion SPTLC1 via lipid raft remodeling and host cell death following bacterial invasion. BMC Microbiology 2010, 10:270.PubMedCrossRef 10. Funke G, von Graevenitz A, Clarridge III JE, Bernard KA: Clinical microbiology of coryneform bacteria. Clin Microbiol Rev 1997, 10:125–159.PubMed 11. Hassan AA, Ulbegi-Mohyla H, Kanbar T, Alber J, Lammler C, Abdulmawjood A, Zschock M, Weiss R: Phenotypic and genotypic characterization of Arcanobacterium haemolyticum isolates from infections of horses. Journal of Clinical Microbiology 2009,47(1):124–128.PubMedCrossRef 12. MacLean PD, Liebow AA, Rosenberg AA: A haemolytic bacterium resembling Corynebacterium ovis and Corynebacterium pyogenes in man. J Infect Dis 1946, 79:69–90.PubMedCrossRef 13.

In this study, we have constructed a phylogenetic profile of forty Francisella selleck inhibitor strains based on whole genome sequences. This to our knowledge is the first report of a phylogenetic model based on nearly complete genomes of multiple strains of F. tularensis using Affymetrix resequencing arrays. We have demonstrated that resequencing KU55933 cell line data may be used to generate high-resolution phylogenetic trees based on global SNPs. The advantage of this sequence-based approach is that SNP based phylogenetic trees can be used for evolutionary analyses. The comparative analysis based on the phylogenetic

relatedness of strains can provide significant insights into the varying degree of phenotypes and ecotypes of an organism. The total number of complete genomes required to achieve an optimum phylogenetic profile from the multiple strains of an organism will be determined by the degree of plasticity of the genome. Adequate phylogenetic relationship can be determined with a sufficient number of genomes from diverse isolates of an organism and the whole genome comparative analysis of such related strains can provide real biological insights

into the adaptation and evolution of a species. Such phylogenetic-based comparative analysis can capture genomic differences Selleck ��-Nicotinamide of very closely related strains and provide valuable information for the development of rapid molecular sequence based assays, capable of discrimination to the strain level. Conclusion The whole genome resequencing array platform provides sequence and SNP information from multiple strains for any infectious agent with an available whole genome sequence. Multi-strain whole genome sequence data allows one to build robust buy Vorinostat phylogenetic models for an organism based on global SNPs. Whole genome SNP based phylogenetic trees can guide meaningful comparative analysis of strains to better understand the biology of an organism as well as in translational research such as in developing high resolution economical SNP based typing assays. We have collected whole genome sequence and SNP information from forty strains

of Francisella to construct a global phylogeny. Our data shows a good correlation with the previously published reports using limited genomic sequence information and also provides higher strain resolution. We used the whole genome SNP phylogeny to identify informative SNP markers specific to major nodes in the tree and to develop a genotyping assay for subspecies and clades of F. tularensis strains. Less diverse type B strains could even be discriminated into two clades, B1 and B2, based on a single SNP. Our whole genome SNP based phylogenetic clustering shows high potential for identifying SNP markers within F. tularensis capable of discriminating to the strain level. This finding should greatly facilitate the rapid and low-cost typing of F. tularensis strains in the future. Acknowledgements We thank Dr.

For all laboratories, on the fifth date, five serum and five urine specimens were sent to each laboratory in order to assess within-run variability of the marker measurements. Each of the six laboratories used one of two assays for urine NTX measurements and one of two assays for serum BAP measurements. For urine NTX, two laboratories (LabCorp and Specialty) used the buy BIBF 1120 Osteomark assay (Inverness Medical Innovations, Waltham,

MA, USA), an ELISA using a monoclonal antibody directed against a urinary pool of collagen cross-links originally derived from a patient with Paget’s disease. Four laboratories (ARUP, Esoterix, Mayo, and BLZ945 manufacturer Quest) used the Vitros enhanced chemiluminescence (ECi) assay (Ortho-Clinical Diagnostics, Rochester, NY, USA), a fully automated platform using the same antigen. For serum BAP, one laboratory (Specialty) used the Metra BAP enzyme immunoassay (Quidel, San Diego, CA, USA), while five laboratories (ARUP, Quest, Esoterix, Mayo, and LabCorp) used Access Ostase (Beckman Coulter, Fullerton, CA, USA), another enzyme immunoassay. Of note,

Metra BAP was formerly called Alkphase-B. Access Ostase was formerly Hybritech Tandem-MP Ostase, which itself was developed from the monoclonal antibody used for the Hybritech Tandem-R Ostase immunoradiometric assay. The laboratories communicated the results Interleukin-3 receptor by fax to the authors’ institutional JNJ-26481585 molecular weight clinical laboratory, as is done for routine clinical specimens. Urine NTX values were reported by all labs in whole numbers; BAP values were reported by four of the labs to one tenth of a microgram per liter or unit per liter but by Esoterix and Mayo as whole numbers. Following standard practice, labs corrected urine NTX values for dilution by urinary creatinine analysis and reported results as NTX/creatinine ratios (to be referred to simply as NTX in this paper). Means,

SDs, and coefficients of variation (CVs, defined as mean/SD) with 95% confidence intervals (CIs) were calculated [8]. A CV for within-run reproducibility for BAP could not be computed for Esoterix because the reported values were rounded to the nearest microgram per liter and did not vary. Two sensitivity analyses were performed: first, a uniform random variate on the interval [−0.5, 0.5] was added to the BAP values reported by that lab and by Mayo, which also rounded to the nearest microgram per liter. Then, the perturbed results were rounded to the nearest 0.1 μg/L, as reported by the other labs. Second, CVs were computed after rounding reported values from all six labs to the nearest microgram per liter (or, for Metra, the nearest U/L).

In the case of the five traditional disciplinary categories, courses were assigned to recognized subject areas following existing classification systems (Australian Bureau of Statistics 1998; Higher Education Statistics Agency 2012; National Centre for Education Statistics 2012). In the case of the five disciplinary categories we added, the process involved multiple readings of all course titles and descriptions in these categories and the iterative development of new subject areas (Fig. 1). Finally, to see if there was a common body of literature being drawn PCI-34051 nmr upon to teach students

the GSK2118436 clinical trial central concepts of sustainability, we requested reading lists via e-mail to the instructor for all core sustainability courses. The syllabi received were examined for commonalities across programs. Results In total, we identified and evaluated 54 programs (27 bachelor’s and 27 master’s degree programs) that met our selection

criteria. The database contained over 200 entries, with 114 programs that included the word “sustainability” or “sustainable”. After removing Selleck AZ 628 those programs that had insufficient information on their website to permit analysis, and those that on closer examination did not fulfil the original criteria Dolichyl-phosphate-mannose-protein mannosyltransferase (e.g., was not a bachelor’s or master’s degree), the sample was reduced to 87. Finally, on qualitative review of the program websites, 54 programs were selected from these as focusing on sustainability, rather than incorporating aspects

of sustainability within an existing discipline, and having enough information for the curricular analysis. The majority of programs that met our criteria for inclusion are located in the United States and the United Kingdom (Table 2). The universities represented range from small private institutions with a few thousand students to large public research universities with over 50,000 students. Programs are offered through undergraduate departments within the natural sciences, social sciences, and/or the arts; interdepartmental umbrella programs; separate academic institutes for sustainability; and graduate schools. Master’s programs require a bachelor’s degree and documents such as academic transcripts, resumes, and scores on standardized tests for admission, but typically do not require any specific disciplinary background or course prerequisites. Table 2 Programs in sustainability included in this analysis at the bachelor’s (N = 27) and master’s (N = 27) level.

After the h-BN nanosheets on NVP-LDE225 supplier graphene were transferred to TEM grids

after the etching of SiO2/Si, atomic resolution HRTEM was used to study the crystalline structure of the aforementioned h-BN nanosheets on their respective graphene substrates. Figure 5a shows a TEM image buy Poziotinib of the h-BN nanosheets on graphene, with the arrows indicating the edge of the graphene. The polygonal objects on the graphene indicated the existence of h-BN nanosheets. The numbers ‘1’ to ‘4’ indicate typical regions of Figure 5a. Region 1 refers to a region of graphene without any h-BN nanosheet thereon, while regions 2 to 4 refer to isolated h-BN nanosheets on the graphene. Figure 5b,c,d shows the atomic images corresponding

to regions 2 to 4, while the corresponding SAED patterns for regions 1 to 4 are shown in Figure 5e,f,g,h, respectively. The regular, periodic SAED spots evinced the high degree of crystallinity of both the find more graphene and h-BN nanosheets.Figure 5b shows that the h-BN nanosheet in region 2 had the same in-plane lattice orientation as the graphene substrate. However, the h-BN nanosheets and graphene in regions 3 and 4 were rotationally displaced, according to their Moiré patterns (see insets of Figure 5c,d, respectively). The h-BN nanosheets on graphene had various in-plane lattice orientations, which were consistent with the SAED patterns of Figure 5f,h. These results were also evinced by the SEM image (Figure 2b), as the triangular h-BN nanosheets on the narrow graphene belt also lay in various directions. Figure 5 Images of h-BN/graphene transferred onto TEM grids. (a) A low-magnification

Branched chain aminotransferase TEM image of h-BN nanosheets on graphene, with the arrows showing the graphene boundary. (b-d) HRTEM atomic images corresponding to regions 2, 3, and 4 in (a), with the insets showing FFT-filtered images, respectively. (e-h) SAED patterns corresponding to regions 1 to 4. Conclusions In summary, we have demonstrated the van der Waals epitaxy of h-BN nanosheets on graphene by catalyst-free CVD, which may maintain the promising electronic characteristics of graphene. The h-BN nanosheets tended to have a triangular morphology on a narrow graphene belt, whereas they had a polygonal morphology on a much larger graphene film. The B/N ratio of the h-BN nanosheets on graphene was 1.01, indicative of an almost stoichiometric composition of h-BN. The h-BN nanosheets preferred to grow on graphene rather than on SiO2/Si, which offered the promise of potential applications for the preparation of graphene/h-BN superlattice structures. The h-BN nanosheets on graphene had a high degree of crystallinity, except for various in-plane lattice orientations.

The AC220 order specificities of the four screening agars have been documented in previous studies focusing on the ability to detect ESBL-producing bacteria within the Enterobacteriaceae family. These studies included none or just a few Nirogacestat order Salmonella isolates, and the specificity varied greatly. ChromID ESBL agar was included in most of the studies, and the specificity ranged

from 72.9% – 94.9% [33-36]. The specificity of the Brilliance agar ranged from 57.9%– 95.1% [33,34,36], and for BLSE agar the specificity ranged from 60.8-85.0% [34,35]. CHROMagar ESBL has been evaluated by Grohs et al. only, with a reported specificity of 72.3% [33]. However, some of the previous studies seem to have included ESBL-producing non-Enterobacteriaceae isolates as test positives, while other studies only included ESBL-producing isolates within the Enterobacteriaceae family. This difference may explain the apparent great variations in specificities reported. The frequency of human infection with Salmonella and Shigella in Norway is relatively low. Consequently, to gain proper statistical power in a real-life study evaluating screening plates for ESBL-positive strains of these two genera would be time consuming. We therefore chose

to use a suspension of a normal fecal sample spiked EPZ-6438 ic50 with the ESBL- positive isolates. The quantity of ESBL-positive bacteria in the fecal samples is known to be a factor of the sensitivity of the screening agars [37]. In genuine fecal samples the quantity of bacteria varies, but Plasmin in this study we spiked the same quantity of bacteria in all samples. Salmonella are normally lactose negative and produce neither β-galactosidase nor β-glucuronidase. Consequently, colonies of Salmonella appeared colourless on agarplates that use these enzymes in the chromogenic reactions. Shigella sonnei is both β-glucuronidase and β-galactosidase-positive and appeared much like E. coli on these screening agars. Therefore direct differentiation of Shigella sonnei and E. coli is difficult. However, none

of the manufacturers mention this similarity in their product information. On the other hand, Shigella flexneri does not express these enzymes, and will not appear like E. coli on the screening agars. This was confirmed in our testing. Obviously, testing only two Shigella flexneri isolates is insufficient to give a statistically reliable result. Three Salmonella isolates of different serovars had pink colonies on both ChromID and Brilliance agars, whereas the rest of the Salmonella isolates had colorless colonies. It is necessary for the pink color formation that the bacteria express β-glucuronidase, which is described that some Salmonella bacteria actually do [38]. The color-based identification was non-specific and comparable to expected results from using a non-chromogenic agar with the same antibacterial supplements.

The

methodology of how to compare different models and its results are described in the next chapter. Results and discussion Comparison of marginal abatement cost curves According to the IPCC AR4 (IPCC 2007), mitigation potentials are defined as “the scale of GHG reductions that could be achieved, relative to emission baselines, for a given carbon price (expressed in cost per unit of carbon dioxide equivalent emissions avoided or reduced)”. Thus, MAC is defined as the abatement costs of a unit reduction of GHG emissions relative to emission baselines. This comparison study follows the same definition and MAC curves in 2020 and 2030 in major GHG emitting countries are shown in Fig. 1 by plotting mitigation potentials mTOR inhibitor relative to the baseline for the each model at a certain carbon price. These MAC curves imply technological mitigation potentials and technological implementation costs resulting from the bottom-up Temsirolimus supplier approach,

which considers various factors such as the current level of energy efficiencies, JNJ-26481585 solubility dmso difference of socio-economic characteristics by country, and scope of renewable energies. Fig. 1 Comparison of marginal abatement cost (MAC) curves in 2020 and 2030 in major greenhouse gas (GHG)-emitting countries and regions. a Japan in 2020 and 2030. b China in 2020 and 2030. c India in 2020 and 2030. d Asia in 2020 and 2030. e US in 2020 and 2030. f EU27 in 2020 and 2030. g Russia in 2020 and 2030. h Annex I in 2020 and 2030. i Non Annex I in 2020 and 2030 However, even at the same carbon price in the same country, mitigation potentials vary widely according to the model, especially for higher carbon pricing both in developed and developing countries. The differences in MAC curve features are caused by various factors in the bottom-up analyses; for example (1) the

settings of socio-economic data and other driving forces; (2) the settings of key advanced technologies and their future portfolios; (3) the assumptions of energy resource restrictions and their portfolios, 4��8C and future energy prices; (4) model components such as the coverage of target sectors, target GHGs, and mitigation options; (5) coverage of costs, such as initial cost, operation and management costs, transaction costs, and related terms, such as the settings of the discount rate and payback period; (6) base year emissions; and (7) the assumptions of baseline emissions. It is important to focus on all these differences when comparing the robustness of MAC curves, but it is difficult to compare all the factors because a MAC curve is a complicated index based on complex modeling results. Consequently, this comparison study focuses on some of these factors in order to analyze the differences in MAC curves.

Results LTT was performed in 13 (17.1%) patients. From the remaining patients, 56 underwent necrotic bowel resection and 7 underwent tromboembolectomy. The median age was 62 years (45–87). There were 11 (84.6%) males and 2 (15.4%) females. All patients presented with acute abdominal pain. There were no patients with a known diagnosis of chronic mesenteric ischemia (CMI). However, history revealed post-prandial pain suggestive of CMI in 3 patients (23%). The median duration of symptoms was 24 h. Four (30.7%) patients presented within 24 h of onset of symptoms, whilst 9 (69.3%) patients presented after 24 h of the onset of symptoms. Diabetes mellitus was present in 8 https://www.selleckchem.com/products/SB-431542.html (61.5%), hypertension in 6 (46.1%), hyperlipidemia

in 2 (15.3%) patients, ischemic heart disease in 7 (53.8%), smoking in 7 (53.8%), and arythmia in 6 (46.1%) patients. Physical examination revealed positive peritoneal signs in 8 (61.5%) patients, while there were not any physical findings in 5 (39.5%) patients. Patients without peritoneal signs on physical examination and with AMI findings on CTA underwent percutaneous SMA catheterization

and LTT. One patient had multiorgan failure during the treatment and died. There were not any signs of intracranial or internal bleeding during the hospitalization of the patient. All other four patients improved and discharged without any further intervention and followed-up by CT- angiography on 3rd, 6th and 1 year follow-up. The admission time was less selleck chemicals than 24 h in four of these patients. There were 2 (15.3%) patients, who presented with peritoneal signs. One of the patients had findings of AMI on CTA. Both patients underwent laparoscopy. Low-flow state without bowel necrosis was positive during the evaluation. Percutaneous access to SMA was achieved and LTT was commenced. After 24 h, a control digital subtraction angiography was performed and revealed recanalization of SMA Edoxaban (Figure 2). There were no signs of peritoneal irritation in these patients; therefore second-look laparoscopy was not planned. Figure 2 24-h digital subtraction angiography control reveals

an improved mesenteric circulation (A) when compared to images obtained before local thrombolytic therapy (B). There were 6 (46.1%) patients, who presented with peritoneal signs. One of the patients had findings of AMI on CTA. He underwent laparoscopy and subsequently laparotomy when positive findings for buy Thiazovivin possible bowel necrosis were revealed during laparoscopy. However, there was not any bowel necrosis and the patient did not undergo bowel resection. He was then referred to LTT. A second-look laparoscopy was performed and there was not any further intervention. The patient died on day 5 of his hospitalization due to myocardial infarction. Three of these patients underwent laparotomy for acute abdomen and AMI was diagnosed during the exploration.

Cognitive functioning was measured using the mini-mental state examination (MMSE, range 0–30) [32]. selleckchem Depressive symptoms were assessed using the Center for Epidemiologic Studies-Depression Scale (CES-D, range 0–60). Fear of falling was measured using a modified version of the Falls Efficacy Scale (FES) [33]. The participants reported how concerned (0 = not concerned, 3 = very concerned) about falling they were while carrying out ten activities AG-881 research buy of daily living (range

0–30). Statistics Differences in baseline characteristics for nonfallers, occasional fallers, and recurrent fallers and were tested using analysis of variance for normally distributed continuous variables, Kruskall–Wallis tests for skewed continuous variables, and Chi-squared tests for dichotomous variables. To examine the association between

physical activity and time to first and recurrent falls, hazard ratios (HR) and 95% confidence intervals (95%CI) were calculated using the Cox proportional hazards model. The analyses were performed univariately and with adjustment for age, sex, chronic diseases, BMI, MMSE, depressive symptoms, psychotropic medication, and fear of falling. First, a quadratic term of physical activity (physical activity2) was included to assess a potential nonlinear relationship. Second, to test effect modification by LY333531 physical performance (physical activity × physical performance) and functional limitations (physical activity × functional limitations), interaction terms were included in separate models. No colinearity between physical activity and physical performance or functional limitations was found (r < 0.21). To test for nonlinearity and interaction, the difference in −2 log likelihood was tested using Chi2-test (p < 0.10). Third, if an interaction term was significant, analyses were stratified by physical performance

N-acetylglucosamine-1-phosphate transferase or functional limitations. P values were based on two-sided tests and were considered statistically significant at p < 0.05. All analyses were conducted in 2008/2009 using SPSS software (SPSS Inc., Chicago, version 15.0.2). Results As compared with responders, nonresponders were older, had lower BMI, more health problems, poorer cognitive functioning, more fear of falling, poorer physical performance, were less active (p for all characteristics ≤ 0.01), and tended to be more often recurrent fallers (p = 0.08). In total, 1,337 participants were included, of whom 167 participants (12%) dropped out during 3 years of follow-up. During 3 years, 740 participants (55.3%) reported at least one fall. Table 1 shows the baseline characteristics for nonfallers (n = 597), occasional fallers (n = 410), and recurrent fallers (n = 330). The three groups clearly differ in all baseline characteristics. The median physical activity in the total sample was 459 min/day × MET (interquartile range = 259–703).