In-solution tryptic digestion of TPP-extracted

proteins Protein samples were resuspended in 1 mL of 0.1% Rapigest (Waters Corporation, Milford, MA) and concentrated using PI3K inhibitor a 5 kDa cut-off spin column. The solution was heated at 80°C for 15 minutes, reduced with dithiothreitol, alkylated with iodoacetamide and digested with 1:50 (w/w) sequencing grade trypsin for 16 hours. RapiGest was hydrolysed by the addition of 2 μL of 13 M trifluoroacetic acid, filtered using a 0.22 μm spin column and each sample was typically diluted to 1 μg/μL prior to a 1:1 dilution with a 100 fmol/μL glycogen phosphorylase B standard tryptic digest to give a final protein concentration of 500 ng/μL per sample and 50 fmol/μL phosphorylase B. LC-MS configurations for label-free analysis (LC-MSE) Nanoscale LC separations of tryptic peptides for qualitative and quantitative multiplexed LC-MS analysis were performed with a nanoACQUITY system (Waters Corporation) using a Symmetry C18 trapping column (180 μm × 20 mm 5 μm) and a BEH C18 analytical column (75 μm × 250 mm 1.7 μm). The composition of solvent A was 0.1% formic acid in water, and solvent B (0.1% formic acid in acetonitrile). Each sample (total digested protein 0.5 μg) was applied to the trapping column and flushed with 0.1% solvent B for 2 minutes at a flow rate

of 15 μL/min. Sample elution was performed at a flow rate of 250 nL/min by increasing the organic solvent concentration from 3 to 40% B over 90 min. Three technical replicate injections of the TPP-extracted

1002 sample and four technical replicates of the TPP-extracted C231 sample were used for subsequent data analysis Vistusertib price in this study. These were from two biological cultures of each C. pseudotuberculosis stain. The precursor ion masses and associated fragment ion spectra of the tryptic peptides were mass measured with a Q-ToF Ultima Global or Synapt HDMS mass spectrometer (Waters Corporation) directly coupled to the chromatographic system. The time-of-flight analyzers of both mass spectrometers were externally calibrated using the MS/MS spectrum from [Glu1]-Fibrinopeptide B (human – Sigma Aldrich, UK) obtained from the doubly Ricolinostat charged peptide Etomidate ion at m/z 785.8426. The monoisotopic mass of the doubly charged species in MS mode was also used for post-acquisition data correction. The latter was delivered at 500 fmol/μL to the mass spectrometer via a NanoLockSpray interface using the auxiliary pump of a nanoACQUITY system at a flow rate of 500 nL/min, sampled every 60 seconds. Accurate mass data were collected in data independent mode of acquisition by alternating the energy applied to the collision cell/s between a low and elevated energy state (MSE). The spectral acquisition scan rate was typically 0.9 s with a 0.1 s interscan delay. On the Synapt HDMS instrument in the low energy MS mode, data were collected at constant trap and transfer collision energies (CE) of 3 eV and 1 eV respectively.

Recently, we reported that snPt1 can induce hepatotoxicity [24]. However, the biological effects of snPt1 on other organs remain unclear. In this study, we evaluated the effect of snPt1

on tissues after single- and multi-dose administration in mice. In addition, we investigated the relationship between platinum particle size and biological response by also testing platinum Lonafarnib in vitro particles of 8 nm in size (snPt8). Methods Platinum particles Platinum particles with nominal mean diameters of less than 1 nm (snPt1) and 8 nm (snPt8) were purchased from Polytech & Net GmbH (Rostock, Germany). The particle Enzalutamide cell line sizes were confirmed using a Zetasizer Nano-ZS (Malvern Instruments, Malvern, UK). The particles were stocked as 5 mg/ml aqueous suspensions.

The stock solutions were suspended using a vortex mixer before use. Other reagents used in this study were of research grade. Animals BALB/c and C57BL/6 male mice were obtained from Shimizu Laboratory Supplies Co., Ltd. (Kyoto, Japan) and were housed in an environmentally controlled room at 23°C ± 1.5°C with a 12-h light/12-h dark cycle. Mice had ad libitum access to water and commercial chow (Type MF, Oriental Yeast, Tokyo, Japan). BALB/c mice were injected intravenously Fludarabine nmr with snPt1 or snPt8 at 5 to 20 mg/kg body weight. C57BL/6 mice were injected intraperitoneally with snPt1 or snPt8 at 10 mg/kg body weight, or with an equivalent volume of vehicle (water). At 24 h after the injection of the vehicle Urocanase or test article, the kidney and liver were collected. For testing the chronic effects of platinum particles, C57BL/6 mice were injected

intraperitoneally with snPt1 or snPt8 at 10 mg/kg body weight, or with an equivalent volume of vehicle (water). Intraperitoneal doses were administered as twice-weekly injections for 4 weeks. At 72 h after the last injection of vehicle or test article, the kidney and liver were collected. All experimental protocols conformed to the ethical guidelines of the Graduate School of Pharmaceutical Sciences at Osaka University. Histological analysis For animals dosed intravenously with snPt1 or snPt8, the kidney, spleen, lung, heart, and liver were removed at 24 h post-injection and fixed with 4% paraformaldehyde. For animals dosed intraperitoneally with snPt1 or snPt8, the kidney and liver were removed at 24 h (for single administration) or 72 h (for multiple administration) post-injection and fixed with 4% paraformaldehyde. Thin tissue sections were stained with hematoxylin and eosin for histological observation. Biochemical assay Serum blood urea nitrogen (BUN) was measured using a commercially available colorimetric assay kit (Wako Pure Chemical, Osaka, Japan) according to the manufacturer’s protocol. In brief, collected serum (10 μl) was combined with 1 ml color A reagent (including urease) and incubated at 37°C for 15 min.

However, in the BI 10773 in vivo context of massive hemorrhage, there are potential limiting factors such as acidosis and refractory shock. From this study, a pH of 7.02 had the best sensitivity on the ROC curve for discriminating survivors and non-survivors. A pH > 7.02 was 100% sensitive at identifying potential survivors, reassuring the clinician that no probable survivors could have been AZD3965 order missed if this pH cut-off was adopted. Thus, a pH of 7.02 may be used as a potential guideline or measure at which the administration of rFVIIa should not be considered for patients who are severely acidotic. The pH level of these

patients appeared to be a key determining factor in the success of rFVIIa. As noted, there was a remarkable 100% mortality noted in coagulopathic and severely

acidotic patients (pH ≤ 7.02) who had high bleeding rates, despite the use of rFVIIa. This is corroborated by recent research suggesting that the efficacy of rFVIIa decreases by 90% when the body pH decreases from 7.4 to 7.0 [17]. However, in a recent animal model of lactic acidosis, the effectiveness of rFVIIa in correcting abnormal INR values at a mean pH of 7.14 was unaffected [18]. This suggests that other factors may influence its efficacy in clinical settings. In keeping with our findings, data from the Australia and GSK2126458 supplier New Zealand Haemostasis Registry on 10 years of the use of rFVIIa in Australia and New Zealand which reports on the outcomes of 2181 trauma cases, the single most important predictor of the effect of rFVIIa

Phosphoprotein phosphatase on bleeding and 28-day mortality was pH [25]. In their multivariate analysis, for every 0.1 decline in pH, there were associated increases in non-responders to rFVIIa use and mortality rates [25]. Their unadjusted analysis on the relationship between 28-day mortality and pH showed that patients with pH < 6.90 had a mortality rate of 98% while the group with 7.3025]. Although the pH of 6.90 did not coincide with our threshold of 7.02, the pattern is apparent that mortality percentage drastically increases with decreases in pH. Logistic regression analysis was conducted and values for the odds ratio were obtained for the effect on bleeding and pH, as well as 28-day mortality and pH. For both, an inverse correlation was seen, in that when pH decreased, the odds ratio for mortality increased [25]. Furthermore, outside of the trauma literature, a study by Karkouti et al. found that the administration of rFVIIa should be expedited in order to increase its efficacy in cardiac surgery [24]. An additional factor that must be considered is the impact of other variables, such as rate of bleeding and baseline physiologic factors on rFVIIa, particularly temperature.

Antimicrob Agents Chemother 2012, 56:5845–5851.PubMedCrossRef 18. Neoh HM, Cui L, Yuzawa H, Takeuchi F, Matsuo M, Hiramatsu K: Mutated response regulator graR is responsible for phenotypic conversion of Staphylococcus CYC202 aureus from heterogeneous vancomycin-intermediate resistance to vancomycin-intermediate resistance. Antimicrob Agents Chemother 2008, 52:45–53.PubMedCrossRef 19. Meehl M, Herbert S, Götz F, Cheung A: Interaction of the GraRS two-component system with the VraFG ABC transporter to support vancomycin-intermediate resistance in Staphylococcus aureus . Antimicrob Agents Chemother 2007,

51:2679–2689.PubMedCrossRef 20. Cui L, Isii T, Fukuda M, Ochiai T, Neoh HM, Camargo IL: An RpoB mutation confers dual heteroresistance to daptomycin and LB-100 in vitro vancomycin in Staphylococcus aureus . Antimicrob Agents Chemother 2010, 54:5222–5233.PubMedCrossRef 21. Watanabe Y, Cui L,

Katayama Y, Kozue K, Hiramatsu K: Impact of rpoB mutations on reduced vancomycin Alisertib susceptibility in Staphylococcus aureus . J Clin Microbiol 2011, 49:2680–2684.PubMedCrossRef 22. Matsuo M, Hishinuma T, Katayama Y, Cui L, Kapi M, Hiramatsu K: Mutation of RNA polymerase beta subunit ( rpoB ) promotes hVISA-to-VISA phenotypic conversion of strain Mu3. Antimicrob Agents Chemother 2011, 55:4188–4195.PubMedCrossRef 23. Passalacqua KD, Satola SW, Crispell EK, Read TD: A mutation in the PP2C phosphatase gene in a Staphylococcus aureus USA300 clinical isolate with reduced susceptibility selleck chemicals llc to vancomycin and daptomycin. Antimicrob Agents Chemother 2012, 56:5212–5223.PubMedCrossRef 24. Jousselin A, Renzoni A, Andrey DO, Monod A, Lew DP, Kelley WL: The posttranslocational chaperone lipoprotein PrsA is involved in both glycopeptide and oxacillin resistance in Staphylococcus aureus . Antimicrob Agents

Chemother 2012, 56:3629–3640.PubMedCrossRef 25. Shoji M, Cui L, Iizuka R, Komoto A, Neoh HM, Watanabe Y: walK and clpP mutations confer reduced vancomycin susceptibility in Staphylococcus aureus . Antimicrob Agents Chemother 2011, 55:3870–3881.PubMedCrossRef 26. Maki H, McCallum N, Bischoff M, Wada A, Berger-Bächi B: tcaA inactivation increases glycopeptide resistance in Staphylococcus aureus . Antimicrob Agents Chemother 2004, 48:1953–1959.PubMedCrossRef 27. Jansen A, Türck M, Szekat C, Nagel M, Clever I, Bierbaum G: Role of insertion elements and yycFG in the development of decreased susceptibility to vancomycin in Staphylococcus aureus . Int J Med Microbiol 2007, 297:205–215.PubMedCrossRef 28. Wada A, Katayama Y, Hiramatsu K, Yokota T: Southern hybridization analysis of the mecA deletion from methicillin-resistant Staphylococcus aureus . Biochem Biophys Res Commun 1991, 176:1319–1325.PubMedCrossRef 29.

(2012) have showed that in nontypeable H. influenzae, the two-component signaling system QseB/C was involved in biofilm formation. Daines et al. (2005) and Selleck Sotrastaurin Armbruster et al. (2009) have observed the role of LuxS and AI-2 luxS-dependent factors which control biofilm formation in non-typable H. influenzae, but they considered as controversial its importance as virulence factor in pathogenesis of the biofilm-associated infections. The change in the structure of the substituent has a significant impact on the physicochemical

properties of the compound (Hulzebos et al., 2001; Martin et al., 2002). In our study, we synthesized and tested derivatives differing from each other by the type of substituents in the thioamide group. The best results were obtained for the compound having the ethyl substituent. From the microbiological point of view, the key factor is the presence of ethyl group which only slightly increases the mass and the volume of the compound compared to derivatives with cyclohexyl or 4-metoxyphenyl substituents. Additionally, lower molecular weight of ethyl derivative can have a significant effect on the antimicrobial properties of this compound. In our opinion, replacement of ethyl group on cyclohexyl or 4-metoxyphenyl in the tested pyrazole derivatives causes a significant decrease of their activity against Haemophilus spp. Besides, ethyl substituent has a limited conformational freedom which may affect selleck chemical selectivity

(Graham, 2001). This is very important information from the point of view of the further modifications of these derivatives and their activity against either biofilm-forming cells or against mature biofilm of Haemophilus spp. In addition, further work is needed to

evaluate the role of pyrazole derivatives during biofilm formation and their influence either on adhesive capabilities of haemophili rods or on quorum-sensing phenomenon. Conclusions N-ethyl-3-amino-5-oxo-4-phenyl-2,5-dihydro-1H-pyrazole-1-carbothioamide, N-(4-metoxyphenyl)-3-amino-5-oxo-4-phenyl-2,5-dihydro-1H-pyrazole-1-carbothioamide, and N-cyclohexyl-3-amino-5-oxo-4-phenyl-2,5-dihydro-1H-pyrazole-1-carbothioamide Bortezomib were tested against H. influenzae and H. parainfluenzae in form of planktonic or biofilm-forming cells. Our study shows that the Adriamycin molecular weight pyrazoles can be inhibitors acting on planktonic or biofilm-forming cells of Haemophilus spp. Additionally, these results allow to expect that this compound will be the starting substance in the search of antimicrobials with low toxicity, showing inhibitory effect against Gram-negative haemophili rods and including anti-biofilm activity. Further investigations should clarify the mechanism of pyrazoles against biofilm formed by haemophili rods. Materials and methods N-substituted-3-amino-5-oxo-4-phenyl-2,5-dihydro-1H-pyrazole-1-carbothioamide derivatives Three N-substituted-3-amino-5-oxo-4-phenyl-2,5-dihydro-1H-pyrazole-1-carbothioamide derivatives have been screened for the antibacterial investigations.

4 mM of each primer in a final concentration of 1× master mix of the HotStarTaq Master Mix Kit (Qiagen, Basel, Switzerland). PCR targeting the 16S rRNA generrs,gyrBhousekeeping gene,pagRIAHL receptor and synthase genes, T3SS ATPasehrcN, and the insertion site of theP. agglomeransgenomic DNA Damage inhibitor island carrying the pantocin genespaaABCand these genes were performed.

Primer sequences and annealing temperature (Tm) for each PCR are shown in Table1. With the exception of thegyrBamplification standard cycling conditions were used for all PCRs with an initial denaturation and activation of the HotStarTaq enzyme for 15 min at 95°C, followed by 35 cycles of denaturation at 95°C for 30 s, annealing at the proper Tmfor 45 s, plus 30 s of elongation at 72°C for every 500 bp of expected amplicon size, ending with a final elongation for 10 min at 72°C. The protocol forgyrBamplification included, after the initial polymerase activation, 42 cycles of denaturation check details at 95°C for 30 s, 30 s annealing at 50°C where the annealing time increased by 2 s/cycle until 40 s were reached, plus 10 s elongation at 72°C where the extension time increased

by 1 s/cycle until 15 s are reached. Positive PCR amplification was verified by loading 5 μl of each reaction on a 1.2% agarose gel. Table 1 PCR primers used for gene amplification and sequencing. Gene(s) Primer name Sequence (5′-3′) Size (bp) Tm (°C) Reference gyrB gyr-320 TAARTTYGAYGAYAACTCYTAYAAAGT 970 50 [63]   rgyr-1260 CMCCYTCCACCARGTAMAGTTC     [63] hrcN hrcN-4r CGAGCAGGAYTCGATGAACG 250 50 [57]   hrcN-5rR CCGGWYTGGTATTCACCCAG     [57] 29-kbp GI mutS-rev CGCCATCGGGATCGGTTCGCC 554 60 This work   narL-rev GCCGTCTGGGCGCTGCAGAACG     Cobimetinib This work

paaABC paaA-fw CTCTTGCCAAAATGGATGGT 2398 55 This work   paaC-rev TTGCAAATTCTGCACTCTCG     This work pagRI pagR-fw GTGAAGGATACYTACTACAACG 1206-29 55 This work   pagI-rev CGAATGCATTGACGGCATGG     This work rrs 16S-8F AGAGTTTGATCCTGGCTCAG 1503 48 [64]   16S-533R AR-13324 TTACCGCGGCTGCTGGCAC     [64]   16S-609R ACTACYVGGGTATCTAAKCC     [65]   16S-1492R ACGGTTACCTTGTTACGACTT     [64] Tm = annealing temperature Sequencing of 16S rDNA, gyrB and pagRI genes PCR amplicons were purified from the PCR mix by washing twice with 50 μl of double-distilled water (ddH2O) on a MultiScreen PCR Plate (Millipore, Molsheim, France), resuspended in 30 μl of ddH2O, and quantified spectrophotometrically as described above. The cycle-sequencing reaction was performed with 20-40 ng of purified PCR product using the ABI PRISM BigDye Terminators v1.1 Cycle Sequencing Kit (Applied Biosystems, Foster City, CA, U.S.A.) according to the manufacturer instructions employing the same primers used for PCR amplification. For 16S rRNA gene sequencing, additional primers 16S-609R and 16S-533R (Table1) were used to obtain complete coverage of the amplicon.

This investigation used an experimental design based on the comparison of three extreme conditions of rearing laying hens: germ-free (GF), specific pathogen-free (SPF) and conventional (C) conditions. GF hens are characterized by the absence of microbiota at the intestinal level. This influences their metabolism and intestinal morphological parameters [20]. SPF hens are raised in strictly hygienic conditions and are not vaccinated. Due to the absence of any interactions with other pathogenic microorganisms, the SPF model is frequently used to explore immunological responses to pathogenic or vaccine antigens [21, 22]. QNZ mw In contrast, C laying hens are bred under commercial conditions

and might occasionally be exposed to pathogens. These contrasting breeding conditions provide extremely wide qualitative and quantitative variations in terms of bacterial populations in contact with the hens: the absence or presence of surrounding microbes and gut microbiota, for the GF or C groups respectively, and an intermediate group, the SPF hens, hosting a controlled microbiota in

a pathogen-free environment. The maintenance of GF hens until they are sexually mature (4–5 months) and beyond requires efficient isolators, sterilized food PF-3084014 chemical structure and water, and qualified animal handlers. These constraints could partly explain why such an animal model has never been used before. In our attempt, the non-contamination of GF hens was not successfully achieved. An agent, Penicilium,

was detected at month four, in two independent isolators, but more importantly, in spite of this fungal contamination, the hens remained free of bacteria relevant to our initial objective. The GF group definitively showed different immunological statuses HDAC inhibitor compared to the C and SPF groups, as reflected by higher expressions of IL-1β, IL-8 and TLR4 genes in the jejunum and cæcum of these groups, compared to the GF group. IL-1β and IL-8 are two pro-inflammatory cytokines which are often used as markers of inflammation [23]. TLR4 is a host cell membrane receptor that detects lipopolysaccharide Ribonuclease T1 from Gram-negative bacteria and elicits innate immune response following bacterial infection. The difference in expression levels of IL-1β, IL-8 among the three groups was larger in the cæcum (2- to 64-fold) than in the jejunum (2- to 4-fold) in the SPF and C groups as compared to the GF group. Such expected differences are probably due to the bacterial load, which is much higher in the cæcum than in the jejunum [24]. In contrast, no differences in IL-1β, IL-8 and TLR4 gene expression were observed in the oviduct (magnum) between the experimental groups. Under normal non-pathogenic conditions, the magnum and the other segments of the hen oviduct (infundibulum, isthmus and uterus) constitute an aseptic environment in which the egg is formed in a 24 hour period [2].

Therefore, the possible differences regarding CYP1A1 MspI polymorphism between the two age groups JNK-IN-8 cell line should be noted in further investigations. However, the data indicated that the potential difference was not evident in the present meta-analysis. The overall data were not stratified selleck chemical by source of controls because all studies concerned the population-based controls, except for one study with limited sample sizes [28]. Hospital-based controls might not be always truly representative of the general population. In addition, the population-based controls in several studies were

not strictly matched to the cases. Thus, any selection bias might exist. Future studies using proper control participants with strict matching criteria and large sample sizes are important for reducing such selection bias. In the present meta-analysis, evident

between-study heterogeneities for the overall data were observed for the three comparisons, respectively, and thus, the random-effect models were utilized. In the subgroup analyses, loss of heterogeneities was also found in the subgroups regarding Caucasian and childhood AML, respectively. Though we tried to minimize the possibility of encountering heterogeneity problems by conducting a careful search of the literature and using rigorous criteria for data pooling, evident heterogeneities still existed in some of the comparisons. Therefore, heterogeneities might be multifactoral. In addition to ethnicity and age groups, other factors such as gender, source of controls, histological types and prevalence of lifestyle factors might also yield the heterogeneities. Several limitations selleck chemicals llc should be concerned in the present Dapagliflozin meta-analysis. First, the primary articles only provided data about Caucasians, Asians and mixed races. Detailed information regarding other ethnicities such as African should be concerned. Second, subgroup analyses regarding gender and other factors such as smoking, drinking and radiation exposure have not been conducted in the present study because

relevant information was insufficient in the primary articles. Third, only studies written in English and Chinese were included in this meta-analysis. Any selection bias should be noted. Furthermore, although the meta-analysis in this study is suggestive, high heterogeneity and lack of significant association in any genetic model among Caucasian and Mixed subgroups or age subgroups observed in this study could also originate from the nature of AML as a genetically heterogeneous disease and further assessment on the relationship between CYP1A1 MspI polymorphism and risk of AML subtypes might provide more instructive information. Additionally, gene-gene and gene-environment interactions should also be considered in the further investigations. In summary, the results of the present meta-analysis suggest that variant C allele of CYP1A1 MspI polymorphism might have an association with increased AML risk among Asians.

PubMed 21. Di Bonaventura G, Pompilio A, Picciani C, Nicoletti M, Zappacosta R, Piccolomini R: Adhesion to and biofilm formation on IB3–1 bronchial cells by Stenotrophomonas maltophilia : implications in cystic fibrosis [abstract]. Clin Microbiol Infect 2008, 14:s178. 22. de Oliveira-Garcia D, Dall’Agnol M, Rosales M, Azzuz AC, Martinez MB, Girón JA: Characterization of flagella produced by clinical strains of Stenotrophomonas maltophilia . Emerg Infect Dis 2002, 8:918–923.PubMed 23. O’Sullivan BP, mTOR inhibitor drugs Freedman SD: Cystic fibrosis.

Lancet 2009, 373:1891–1904.PubMedCrossRef 24. Ryan RP, Monchy S, Cardinale M, Taghavi S, Crossman L, Avison MB, Berg G, Lelie D, Dow JM: The versatility and adaptation of bacteria from the genus Stenotrophomonas . MM-102 chemical structure Nat Rev Microbiol 2009, 7:514–525.PubMedCrossRef 25. Graff GR, Burns Epacadostat JL: Factors affecting the incidence of Stenotrophomonas maltophilia isolation in cystic fibrosis. Chest 2002, 121:1754–1760.PubMedCrossRef 26. Goss CH, Otto K, Aitken ML, Rubenfeld GD: Detecting Stenotrophomonas maltophilia does not reduce survival of patients with cystic fibrosis. Am J Respir

Crit Care Med 2002, 166:356–361.PubMedCrossRef 27. Nicodemo AC, Paez JI: Antimicrobial therapy for Stenotrophomonas maltophilia infections. Eur J Clin Microbiol Infect Dis 2007, 26:229–237.PubMedCrossRef 28. Kirisits MJ, Parsek MR: Does Pseudomonas aeruginosa use intercellular signalling to build biofilm communities? Cell Microbiol 2006, 8:1841–1849.PubMedCrossRef 29. Ewig S, Soler N, Gonzalez J, Celis R, El-Ebiary M, Torres A: Evaluation of antimicrobial treatment in mechanically ventilated patients with severe chronic obstructive pulmonary disease exacerbations. Crit Care Med 2000, 28:692–697.PubMedCrossRef 30. Valdezate S, Vindel A, Maiz L, Baquero F, Escobar H, Cantón R: Persistence and variability of Stenotrophomonas maltophilia in

Meloxicam cystic fibrosis patients, Madrid, 1991–1998. Emerg Infect Dis 2001, 7:113–122.PubMedCrossRef 31. Sampaio SC, Gomes TA, Pichon C, du Merle L, Guadagnini S, Abe CM, Sampaio JL, Le Bouguènec C: The flagella of an atypical enteropathogenic Escherichia coli are required for efficient interaction with and stimulation of IL-8 production by enterocytes in vitro. Infect Immun 2009,77(10):4406–13.PubMedCrossRef 32. Yonekura K, Maki-Yonekura S, Namba K: Growth mechanism of the bacterial flagellar filament. Res Microbiol 2002, 153:191–197.PubMedCrossRef 33. Stepanoviæ S, Vukoviæ D, Hola V, Di Bonaventura G, Djukiæ S, Cirkoviæ I, Ruzicka F: Quantification of biofilm in microtiter plates: overview of testing conditions and practical recommendations for assessment of biofilm production by staphylococci. APMIS 2007, 15:891–899.CrossRef 34. Pompilio A, Piccolomini R, Picciani C, D’Antonio D, Savini V, Di Bonaventura G: Factors associated with adherence to and biofilm formation on polystyrene by Stenotrophomonas maltophilia : the role of cell surface hydrophobicity and motility. FEMS Microbiol Lett 2008, 287:41–47.PubMedCrossRef 35.

Generally, based on the well-accepted conductive filament hypothesis to explain the memory functional performance, several nanometer-sized filaments are indeed found in the so-called forming process. However, the conductive filament model could not clarify Erismodegib clinical trial the origin of energy. Recently, the Selleckchem NSC23766 random circuit breaker network model [2, 3] and conical shape filament model [4, 5] are differently developed to emphasize joule heat contribution

on breaker and thermochemical-type resistance switching, respectively. The long switching time and large power consumption of RESET (transition from a low resistance state (LRS) to a high resistance state (HRS)) process need improvements [6]. Therefore, it is important to understand the joule heat generation in resistive switching RESET behavior for the fundamental understanding. A general thermal chemical reaction (TCR) model for the RESET process has been studied by calculating the filament temperature [7]. However, we found that only the TCR itself could not explain the whole RESET process,

especially for the RESET behaviors at different temperatures. In this work, we investigated the RESET process of NbAlO-based resistive switching PND-1186 mouse memory device in detail at low temperatures and clarified the involved charge trapping effect. Methods A NbAlO film (10 nm) was fabricated on a Pt/SiO2/Si substrate via atomic layer deposition (ALD) at 300°C using Al(CH3)3 and Nb(OC2H5)5 as the precursor and H2O as the oxygen source. After deposition, the sample was post-annealed in O2 ambient at 400°C for 10 min. The TiN top electrodes with the diameter of Ribonucleotide reductase 100 μm were fabricated by reactive magnetron sputtering. Chemical bonding state and the microstructure of the NbAlO layer was measured through X-ray photoelectron spectroscopy (XPS) and

transmission electron microscopy (TEM), respectively. The compositions of NbAlO were 1:2:5.5, as confirmed through Rutherford backscattering methods. The samples were placed on a cryogenic Lakeshore probe station (Lake Shore Cryotronics, Inc., Westerville, USA) and cooled with nitrogen liquid. The electrical characteristics were measured at increasing temperatures from 80 to 200 K in an interval of 10 K using a Keithley 4200-SCS semiconductor parameter analyzer (Keithley Instruments Inc., Ohio, USA) with the voltage applied on top electrode of TiN while the bottom Pt electrode was grounded. Because of the overshoot phenomenon with a small current compliance [8], 5 mA was chosen as the current compliance to protect the samples from electrical breakdown during the SET (transition from HRS to LRS) process.