83 mg/kg) or FK565 (0.003 mg/kg) + LPS (0.83 mg/kg) further diminished the distance traveled when compared with LPS alone, or MDP and FK565, respectively ( Fig. 4C). The entries made into the center of the field depended on LPS (F(1,42) = 31.001, p < 0.001), while the effect of the NOD agonists and their interaction with LPS did not reach significance ( Fig. 4B). The time spent in the central area of the OF was not significantly affected by any of the compounds ( Fig. 4A). In experiments

with the lower dose of LPS (0.1 mg/kg), LPS alone, MDP + LPS (0.1 mg/kg), check details as well as FK565 + LPS (0.1 mg/kg) reduced the time spent in the central area of the field (Fig. 4D) and the entries made to the central area (Fig. 4E) without affecting the total distance traveled (Fig. 4F). The combination of FK565 + LPS had the most pronounced effects. While the time in the central area was reduced in all groups (F(3,25) = 7.176, p = 0.001) ( Fig. 4D), the entries made Selleck Verteporfin to the central area of the field were solely reduced by FK565 + LPS (F(3,25) = 6.256, p < 0.01) ( Fig. 4E). LPS (0.1 mg/kg) did not change any behavioral parameter in the FST. In contrast, combined treatment with MDP + LPS and FK565 + LPS induced a slight increase of immobility and a decrease of the duration of time spent swimming,

but these changes did not reach statistical significance (Table 1). Likewise, in the TST there were no significant changes in the duration of immobility, swinging or curling by any of the treatments (Table 1). MDP, FK565 and LPS, alone and in combination, had distinct effects to enhance the circulating levels of proinflammatory cytokines (Fig. 5). Three hours after injection, there was a significant NOD × LPS interaction with regard to the circulating levels of IFN-γ (F(2,39) = 6.004, p < 0.01), IL-1β (F(2,40) = 6.274, p < 0.01), IL-6 (F(2,40) = 7.092, p < 0.01) and TNF-α (F(2,40) = 7.665, p < 0.01) ( Fig.

5A–D). Post-hoc analysis revealed that treatment with MDP (3 mg/kg) or FK565 (0.003 mg/kg) alone did not induce significant increases in the plasma levels of the cytokines measured ( Fig. 5). LPS (0.1 mg/kg) alone increased circulating IL-1β and IL-6 levels compared to VEH ( Fig. 5B and C). In contrast, treatment with MDP or FK565 + LPS increased Phospholipase D1 the levels of all circulating cytokines under study relative to MDP and FK565, respectively ( Fig. 5A–D). In addition, the cytokine levels in the MDP + LPS group were significantly higher than in the LPS group and with regard to IL-6 and TNF-α were even larger than in the FK565 + LPS group ( Fig. 5C and D). The cytokine levels in the FK565 + LPS group were increased compared to LPS for all measured cytokines except TNF-α. Twenty-six hours after treatment, the circulating levels of IFN-γ, IL-1β, IL-6 and TNF-α had largely decreased in all groups studied and were below the detection limit in many samples (Fig. 5E–H).

3a, b, fifth CYC202 datasheet dark gray column from the left). By contrast, with the exception of the condition in which it was co-expressed with cytFkpA, most of the XPA23 Fab expressed with or without chaperones was non-functional, as evidenced by the low amount of binding in the target-specific ELISA (ELISA

absorbance at 450 nm was less than 0.1). The amount of functional murine 83-7 Fab expressed in the periplasm, assessed by target ELISAs (Fig. 3c, dark gray columns) was improved when co-expressed with cytFkpA (Fig. 3c, fifth set of columns from the left). Since the above results demonstrated that co-expression with cytFkpA and, in very few cases, cyt[Skp + FkpA] provided the greatest benefit for Fab secretion, we evaluated the effects of these chaperones on two additional human kappa Fabs, BM7-2 and CF1, which bind a human tyrosine kinase and Tie-1, respectively. Total and functional amounts of BM7-2 or CF1 Fab in the periplasm were measured by expression (Fig. 4, light gray columns) and target (Fig. 4, dark gray columns) ELISAs, respectively. The cytFkpA chaperone construct improved the functional BM7-2 and CF1 Fab expression (Fig. 4a and b, respectively), but to a lesser extent than

XPA23 or ING1 Fabs. Unlike kappa light chains, lambda light chains do not contain framework proline residues in the cis conformation. Since in addition to its catalytic proline see more isomerization activity, FkpA functions as a molecular chaperone, we measured levels of total and functional gastrin-specific Fabs, C10, D1, and E6, which contain lambda light chains, co-expressed with cytFkpA or cyt[Skp + FkpA].

The benefit of cytFkpA expression on secretion of functional Fabs containing lambda light chains was less apparent than with kappa Fabs in that C10, D1, and E6 Fab periplasmic expression did not benefit from co-expression with cytFkpA ( Fig. 5). It appears that simultaneous expression of cytSkp and cytFkpA Tenoxicam decreased the expression of C10, D1, and E6 Fabs ( Fig. 5) possibly due to negative influence of Skp expression in the bacterial cytoplasm. Fab expression also can be quantified by SPR by first capturing Fab fragments with anti-human Fab antiserum immobilized on a Biacore sensor chip. For this study, we tested levels of Fab in the periplasm upon co-expression with the chaperone constructs that generated more substantial expression improvements based on ELISA results. To quantify Fab levels, a standard curve was generated using a control human Fab; periplasmic Fab concentrations were estimated based on SPR resonance units (RUs) in relation to the standard curve (see Table 1). Since the kappa Fab fragments used in this study share identical constant regions, the affinity of the secondary antibodies used to detect the Fabs should be very similar. Cytoplasmic expression of cytFkpA resulted in 5.3 to 7.6-fold and 5.

6.4 software (Fig. 5C,D), with the number of pixels reflecting the intensity Sirolimus molecular weight of immunolabeling; this quantification allowed the comparison of OPN expression (Fig. 5E). Basal OPN labeling in controls did not vary significantly

over time. In envenomed muscle, OPN expression was significantly increased from 3 h to 14 days post-venom; maximal expression occurred at 3 days (31 ± 3.1%), and was slightly lower at 7 days (27 ± 1.2%) and 14 days (24.2 ± 3.2%) post-venom. At 21 days post-venom, the pixel density did not differ from the PBS control or envenomed muscle after 1 h. Image analyses of venom-treated muscles at 3 days post-venom showed double-labeled macrophages next to the endomysial space (alkaline phosphatase reaction in red plus peroxidase-based mTOR inhibitor reaction in brown for CD68 and OPN, respectively) and in close contact with OPN-labeled muscle fibers (Fig. 6). The 3 day post-venom interval was chosen for double labeling because it corresponded to peak of OPN expression in muscle fibers. OPN reactivity was strong in the regenerating region

of envenomed muscle, but was rare or absent in regions not affected by venom. Fig. 7A–C shows regenerating fibers at 7 days post-venom. The muscle proliferative region contained mainly myotubes, with myoblasts being rarer. Both myoblasts (proliferative cells) and myotubes (differentiating cells) were strongly positive for OPN; mature fibers were also OPN+ (Fig. 7A,B). OPN-positive fibroblasts

were observed in the interstitium (Fig. 7C). Although the number of macrophages was highly reduced, their reactivity was as strong as in the previous time intervals (Fig. 7D). At day 7 post-venom, when myogenin expression was at its peak, this protein was detected in the nucleus and cytoplasm of myoblasts and myotubes (Fig. 8A,B) whereas at subsequent intervals it was expressed only in the nucleus. Myogenin expression in envenomed pheromone muscle was significantly greater than in control muscle from 18 h to 14 days post-venom, with a peak at 7 days (152.63 ± 60.45) followed by a decrease thereafter (Fig. 8C). No immunolabeling for anti-myoD was observed at any time interval, despite several attempts using different dilutions and incubation protocols. B. lanceolatus venom produced local tissue damage compatible with disturbances in hemostasis. At 3–6 h post-venom there was extensive hemorrhage, with inflammatory neutrophils and macrophages disseminated amongst the swollen or disintegrated muscle fibers. Class P-I ( Stroka et al., 2005) and P-III ( Gutiérrez et al., 2008) Zn2+-dependent metalloproteinases present in this venom probably contributes to the observed muscle damage, and inflammatory response, as also reported for other Bothrops venoms ( Gutiérrez, 1995; Rucavado et al., 1998, Rucavado et al., 2002 and Laing et al., 2003).

The GCC center for infection control

distributed its second edition of the GCC surveillance manual in 2011 and has conducted many surveillance training activities to unify HAI surveillance systems in the region. However, GCC hospitals still need to overcome legislative and logistic difficulties in sharing PR-171 solubility dmso data to create their own benchmark. The availability of a regional GCC benchmark that addresses many of the above challenges may better enable health care workers and researchers to obtain more accurate and realistic comparisons and may positively impact infection control standards and patient safety in the region. No funding sources. None declared. Not required. “
“The management of non-small cell lung cancer is rapidly evolving toward personalized therapy based on molecular markers. This advancement was facilitated by the development of targeted therapy that was proven efficacious in clinical trials. The availability of newer therapies and the incorporation of markers in the treatment decision will have impact on the standard of care, not in that setting only but also in the subsequent lines of therapy. The Saudi Lung Cancer Guidelines published in this Journal Roxadustat in vitro are the result of efforts by multidisciplinary team members

representing Saudi Lung Cancer Group in Saudi Thoracic Society (STS) and Saudi Oncology Society (SOS) and representing various tertiary institutions in the Kingdom. These guidelines incorporated the latest evidences emerged from recent trials and took into account any relevant regional issues. Many thanks Adenosine to all members of this group and we are looking to any constructive feedback from our readers. Saudi Lung Cancer Guidelines Group: Dr. Abdulrahman Al Hadab, King Saud bin Abdulaziz University for Health Sciences, Riyadh, KSA “
“Lung cancer is the leading cause of cancer-related mortality in Canada and USA [1]. The American Cancer Society has estimated that in 2011 over

200 000 patients will be newly diagnosed with lung cancer, more than 15 000 patients will die of this disease. Non-small cell lung cancer (NSCLC) accounts for approximately 87% of lung cancers [2] and [3]. For last decades systemic chemotherapies especially platinum based doublets, have been used to treat NSCLC, but outcome improvements have reached a plateau [4] and [5]. The medium survival when platinum-based doublets are administered for advanced NSCLC has improved from 4 to 5 months if untreated to 8–10 months, but this treatment causes significant toxicities, which limit the number of cycles to be administered [6]. Current treatment algorithms for the treatment of NSCLC recommend both histologic and molecular diagnostics [7].

Survivors may not return to baseline level of function and may require long-term care facilities after discharge from the hospital. Patient and family preferences for goals www.selleckchem.com/products/BEZ235.html of care should be explored as early as possible and incorporated into treatment plans. Leslie L. Davis This article discusses selected cardiovascular conditions that nurses encounter when caring for elders hospitalized in the intensive care unit. Physiologic changes that predispose elders to these conditions, typical signs and symptoms, common

diagnostic tests, and evidence-based treatment for this population are included. The implications for nursing care of critically ill elders who have these conditions are also discussed. Delia E. Frederick This article elicits why critical care nurses need to become aware of the pulmonary issues of older adults. The population of older adults is increasing. Older adults undergo anatomic and physiologic changes of the protective mechanisms of the pulmonary system. These changes alter the rate and effort of breathing. Speech is slowed because of expiratory strength effort. Cognition changes may be the only indication of impaired oxygenation.

Bedside nursing care provides protection from pulmonary complications. Health behaviors of smoking cessation, oral hygiene, and exercise Bortezomib clinical trial promote pulmonary health even in older adults. Bryan Boling Renal issues are among the most commonly encountered complications in the intensive care unit, Acesulfame Potassium increasing mortality, morbidity, and health care costs. Older adult patients face an increased risk because of several factors, including the normal effects of aging and a higher rate of comorbid conditions that may affect kidney function. This article describes the classification of renal dysfunction, the effects of aging on kidney function, as well as additional risk factors, management strategies,

and outcomes in the older adult population. Helen W. Lach, Rebecca A. Lorenz, and Kristine M. L’Ecuyer Critical illness can impose immobility in older patients, resulting in loss of strength and functional ability. Many factors contribute to immobility, including patients’ medical conditions, medical devices and equipment, nutrition, use of restraint, and staff priorities. Early mobilization reduces the impact of immobility and improves outcomes for older patients. Several important components make up successful mobility programs, including good patient assessment, a core set of interventions, and use of the interprofessional health care team. Nurses can lead in improving the mobilization of older critical care patients, thus reducing clinical risk in this vulnerable population. Laura M. Struble, Barbara J. Sullivan, and Laurie S.

Gram-negative bacilli were identified by biochemical testing (triple sugar iron agar, motility, lysine decarboxylase, indole production, citrate and urea utilization) or API 20E (bioMérieux, Marcy l’Etoile, France). Putative S. enterica isolates were confirmed by agglutination with specific antisera (Bio-Rad, Hemel Hempstead, Hertfordshire, UK). Antimicrobial susceptibilities

were performed at the time of isolation by a modified Bauer-Kirby disc diffusion method, inhibition zone sizes were recorded and interpretations of the zone sizes were based on the latest CLSI guidelines.12 The antimicrobials tested (Oxoid) were chloramphenicol (30 μg), ampicillin (10 μg), trimethoprim–sulphamethoxazole Trametinib clinical trial (1.25/23.75 μg), ceftriaxone

(30 μg), ciprofloxacin (5 μg), azithromycin (15 μg) and nalidixic acid (30 μg). Isolates were stored in Tryptic Soy Broth with 20% glycerol at −80 °C. A representative selection of 102 stored S. enterica Typhi isolates were later subcultured and the minimum inhibitory concentration (MIC) determined by E-test strips according to the manufacturer’s guidelines (AB Biodisk, Solna, Sweden). The evaluated antimicrobials were ciprofloxacin, gatifloxacin, ceftriaxone and azithromycin. Escherichia coli ATCC 25922 and Staphylococcus aureus ATCC 25923 were used as control strains for these assays. An isolate was defined as MDR if it was resistant to all of the following: chloramphenicol (≥32 μg/ml), ampicillin (≥32 μg/ml) selleck and trimethoprim/sulfamethoxazole (≥8/152 μg/ml). Intermediate susceptibility to ciprofloxacin (formerly known as decreased ciprofloxacin susceptibility) was defined AZD6244 by an MIC of 0.12–0.5 μg/ml and resistance

by an MIC of ≥1 μg/ml. 12 The equivalent values for gatifloxacin were 4 μg/ml and ≥8 μg/ml and for ceftriaxone 2 μg/ml and ≥4 μg/ml. There are no recommended CLSI breakpoints for azithromycin against Salmonella. We sought to distinguish the H58 serovar Typhi strains, as these are the most common and ubiquitous across Asia, from non-H58 strains by inferring genotype though the detection of the H58-specific single nucleotide polymorphism (SNP) using a modified pyrosequencing technique. Salmonella Typhi belong to haplotype H58 if the SNP at nucleotide 252 on the gene glpA (corresponds to STY2513 from GenBank accession no. AL513382, Salmonella Typhi CT18) is T, otherwise they belong to non-H58. 13 The common SNPs inducing intermediate susceptibility to ciprofloxacin, located at position 83 and 87 in the gyrA gene and position 80 in the parC gene, were also determined by modified pyrosequencing. 7 Genomic DNA was prepared from the bacterial isolates using the Wizard genomic DNA purification kit (Promega, Madison, WI, USA). The prepared DNA was PCR amplified using the following primer pairs targeting the regions containing the H58 SNP: forward primer 5′biotin GTAACGTCAGCCGCGGTATT; reverse primer 5′ GCCATCAGGCGATAAGTCATTA 3′.

Papers of particular interest, published within the period of review, have been highlighted as: • of special interest XXZ is supported by a Stanford Graduate Fellowship. MZL is supported by NIH grant 1R01NS076860-01, the Rita Allen Foundation, and the Burroughs Wellcome Foundation. “
“Current Opinion in Chemical Biology 2013, 17:691–698 This review comes from a themed issue on Molecular imaging Edited by James Chen and Kazuya Kikuchi For a complete learn more overview see the Issue and the Editorial Available online 13th June 2013 1367-5931/$ – see front matter, © 2013 Elsevier Ltd. All rights

reserved. http://dx.doi.org/10.1016/j.cbpa.2013.05.020 Biophysical techniques have been invaluable to gain a detailed understanding of biological systems PF-02341066 supplier often providing quantitative and time-resolved data that complement data obtained by traditional biochemical experimental setups. Especially single molecule techniques like atomic force spectroscopy (AFM), magnetic and optical tweezers, fluorescence correlation spectroscopy (FCS) and single-molecule fluorescence

spectroscopy provide exceptionally rich datasets that combine structural information with high time resolution [1•, 2 and 3]. Because single molecule techniques avoid the averaging effect seen in bulk experiments, subpopulations, competing reaction pathways and transient intermediates can be identified. A fluorescent molecule is a highly sensitive molecular probe rich in information and sensitive to its environment. Among the

measurable parameters are the spectral properties of the fluorophore (absorption and emission), the fluorescence intensity (‘brightness’), the quantum yield, the fluorescence lifetime and anisotropy. The use of two fluorophores in Förster resonance energy transfer Etomidate (FRET) measurements [4, 5 and 6] extends this set of variables to include the stoichiometry between the probes in the complex, their interaction with each other and the distance between them. All of these parameters can be obtained individually or in combination via multiparameter fluorescence detection [7, 8 and 9]. Thereby, single molecule fluorescence measurements provide a wealth of information that inform directly about the status of a molecule. Still, many experiments cannot be carried out at the level of single molecules as many obstacles remain. Here, we review the recent advances to develop minimally invasive labelling schemes, to measure under physiological relevant conditions and to expand the range of concentrations suitable for single molecule measurements. Of paramount importance for successful single molecule experiments is the quantitative and site-specific modification of molecules with fluorescent probes. For biological applications, a fluorescent label is ideally a small and water-soluble molecule in order to avoid aggregation and to prevent non-specific interactions with the biomolecule via hydrophobic interactions.

Alimentary-dependent diseases are currently called “epidemics” of civilization, as evidenced by an increase in of their frequency and severity

as well as by many long-term adverse health effects [5], [6], [7], [8] and [9]. About 35% of diseases in children aged less than 5 years are associated with certain nutritional disorders. WHO estimated that globally in 2012, 162 million children under five were stunted and PCI-32765 supplier 51 million had a low weight-for-height ratio, mainly as a consequence of improper feeding or recurrent infections, while 44 million were overweight or obese. Few children receive nutritionally adequate and safe complementary foods. In many countries only a third of breastfed infants aged of 6–23 months receive complementary feeding which is appropriate to their age criteria of dietary diversity and feeding frequency [17]. According to a national population-based study in the U.S. that evaluated feeding habits of children during the first 4 years of life in 2008 comparing to 2002 the proportion of infants who were breastfed at 8 and 12 months as well as the average age of children at the time of solid food introduction increased. However, the level of unmodified cow’s milk consumption during the first year of life (17% in 2008 vs. 20% in 2002) and skim milk intake in the second year of life (20–30% vs. 20–40% respectively) did not change [18]. Consumption of fruits and vegetables

Veliparib molecular weight by all children aged 6 months – 4 years remained insufficient also. Specifically, 30% of them did not eat any vegetables and 25% – any fruits on the survey day [19]. At the same time, fried potato was the favorite vegetable dish in children older than 2 years. The diet of many children aged 1–3 years did not contain enough vitamin E, potassium and dietary fiber, but

too much sodium, and some of them did not consume enough iron and zinc [18]. The ratio between separate nutrients was broken, in particular, the diet proportion of fat did not provide 30–40% of energy needs, primarily due to excessive protein intake [20]. In children older 12 months the diet diversity was becoming narrower with a negative tendency to increase the proportion of nutritionally inadequate snacks, sweets, sugary and carbonated beverages. The study conducted in 2012 in Russia also found a high Ergoloid prevalence of various nutritional violations leading to the emergence of various deficient conditions in children aged of 13–36 months [21]. Taking into account the importance of balanced nutrition in early childhood, its impact on the subsequent formation of the body tissues and maintaining health, epidemiological observational studies for comprehensive assessment of nutrition in young children are of paramount importance. Nowadays in Ukraine we are limited with scientific data about nutritional status of young children, prevalence of eating behavior disorders and deficits in basic macro- and micronutrients in children’s diet.

Here we described a method for isolation and establishment of oenocytes from mosquito pupae in culture. Mosquito oenocytes

can be maintained in primary cultures for up to 2 months. Cultured oenocytes tend to form clusters similarly to previously described for oenocytes in Drosophila ( Hartenstein et al., 1992, Elstob et al., 2001 and Gould et al., 2001) and in Ae. aegypti larvae ( Wigglesworth, 1942). Oenocyte clusters are formed during Ae. aegypti metamorphosis and are thought to spread throughout the interior and the periphery of the mosquito fat body during the imago development ( Christophers, 1960). We investigated the morphology of cultured pupae oenocytes via TEM, SEM and light microscopies. Overall, cultured oenocytes maintained main cytoplasmic characteristics found in freshly isolated cells, such as the general chromatin organization in the nucleus, and the ovoid shape of the cells with the cytoplasm filled with SER and vesicles. Antiinfection Compound Library clinical trial However, we noticed a decrease in the mitochondria number and size in the cultured cells. Interestingly, fresh and cultured oenocytes from pupae were

quite different from adult mosquito oenocytes. For instance, in pupae, the SER almost completely filled the cytoplasm, while in adults the SER was restricted to some areas of the cytoplasm. HDAC inhibitors list Also in adults, the plasma membrane displayed deeply invaginated canaliculi (supplementary data) which were not detected in either fresh or cultured

oenocytes. Moreover, adult oenocytes were polymorphic, clearly distinct from the rounded pupae cells (supplementary data), also reported by Tadkowski et al. (1977). Pupal oenocytes had DNA ligase prominent SER and numerous bundles of vesicles. It can be inferred that these vesicles corresponded to lipid droplets that were abundantly found in the D. melanogaster larval oenocytes ( Gutierrez et al., 2007) and in adult ant oenocytes ( Camargo-Mathias and Caetano, 1996 and Roma et al., 2008). These two organelles have been associated with the oenocyte lipid metabolism and storage in the caterpillar Calpodes ethlius (Lepidoptera) ( Locke, 1969) and in adults of T. molitor (Coleoptera) ( Romer et al., 1974), S. gregaria (Orthoptera) ( Diehl, 1973 and Diehl, 1975) and B. germanica (Blattaria) ( Fan et al., 2003). The ruthenium red is specific for cell surface staining and indicated the presence of a lymph space on the external surface of fresh oenocytes. This is also known as reticular system and was reported in oenocytes and trophocytes of C. ethlius pupae ( Locke, 1969 and Locke, 1986). Lymph spaces are formed through plasma membrane protrusions that increase the cell surface area (reviewed by Locke, 2003). However, lymph spaces were no longer observed after cell culturing. Modifications of the surface of cells also included the formation of pseudopodia (filopodia and lamellipodia), which were due to cultured settling on the glass substrate.

Hence, at sites with more than 3 m of water, the bottom reflectance contributes nothing to Lwnred although the latter remains sensitive to resuspended bottom sediments penetrating the near-surface layer. In other words, the 3 m depth is a universal threshold of red radiance sensitivity to bottom reflection ( Figure 1), and the similarity of the horizontal distributions of Lwnred and Lwnref over the shallow area points to a particularly strong resuspension GSK126 cell line of bottom sediments, because Zor for Lwnref delimits a much thicker surface layer than Zor

for Lwnred does (Lwnref /Lwnred criterion). We chose a shallow in the south-eastern Caspian Sea as the study area (Figure 2) because it has the features of a desired natural model: (1) the waters of the South Caspian basin, flowing across the shallow, are fairly transparent (Simonov & Altman 1992), which facilitates observations of resuspension effects; (2) the bed of the shallow is mainly free of sea grass and consists of bare sand, silt and other light-coloured sediments that are detachable from the sea floor by quite moderate water motions; (3) digital bottom topography of the Caspian

Sea is available online at http://caspi.ru/HTML/025/02/Caspy-30-10.zip (Figure 2b); (4) the shallow extends for about 200 km in latitude and from 40–50 to 110–120 km in longitude and is clearly delimited DAPT chemical structure by the shore line in the east and by an underwater precipice to the west of the 20–30 m depth contours (Figure 2b); (5) only a few rivers with a minor discharge rate enter the south-eastern Caspian Sea, which minimizes the occurrence of externally supplied sediments; (6) the bottom relief is fairly smooth at sites of plausible sediment resuspension (depth range up to 15–20 m, Figure 2b); (7) the south-eastern Caspian Sea is a region where sunny weather prevails. Our approach implies the use of a long-term data set of the Sea-viewing Wide Field-of-view Sensor Fluorouracil concentration (SeaWiFS), since it is equipped with a sun-glint avoidance facility. Use has been made of archived water-leaving radiance distributions at wavelengths 412, 443, 490, 510, 555 and 670 nm as standard

level L2 products with pixel size 1.1 × 1.1 km, collected during the NASA global ocean mission in the 1999–2004. The second data set involves the daily estimates of the near-water before-noon wind vectors obtained at 15′ spacing with the scatterometer QuickScat in 1999–2004 and available at http://poet.jpl.nasa.gov. We restricted ourselves to eight wind velocity directions with the following designations and mean azimuths φi: S-N, φ1 = 0°; SW-NE, φ2 = 45°; W-E, φ3 = 90°; NW-SE, φ4 = 135°; N-S, φ5 = 180°; NE-SW, φ6 = 225°; E-W, φ7 = 270°; SE-NW, φ8 = 315°. Any wind vector in the range φi ± 22°30′ was assigned to the i-th direction. The SeaWiFS and QuickScat data and the bottom bathymetry were displayed for every year day (YD) as superimposed maps of the testing area (Figure 2).