PCR and sequencing of the gerA operon Primer A7F and A7R (Table  2) were used to amplify a 718 bp region of the gerA operon, including 3′ end of gerAB and 5′ end of gerAC. Additionally, complete gerA operons from strain NVH800, NVH1032 and NVH1112 were amplified in smaller fragments for DNA sequencing using primers listed in Additional file 8. All amplification reactions were this website performed in 20 μL using 2 μL DNA (10 ng μL-1) as a template. PCR reactions were performed in a LightCycler® 480 System using LightCycler® 480 SYBR Green I Master (Roche Diagnostics GmbH, Germany) according

to recommendations given by the manufacturer of the kit. The temperature program was as follows: 5 min initial denaturation at Verubecestat molecular weight 95°C followed by 35 cycles of denaturation at 95°C for 10 s, annealing at 56°C for 10 s and extension at 72°C for 30 s. The amplifications were terminated after a final elongation step of 7 min at 72°C. The PCR fragments were verified by electrophoresis using Bioanalyzer (Agilent Technologies, USA). PCR products were purified and sequenced by Eurofins MWG Operon (Ebersberg, Germany) using the dideoxy chain termination method on an ABI 3730XL sequencing instrument (Applied Biosystems, USA). Table 2 Primers used in this study Primer Sequence Application Amplicon size A7F 5′- GGATTTGGGATACCGCTCTT

-3′ gerA detection/sequencing 718 bp A7R 5′- TGCAGATGCTGCGAGAATAC -3′ gerA detection/sequencing 718 bp gerAAF MW3 5′- CCCTGTTCCTATCGGCGTTT -3′ RT-PCR (E = 2.01) 59 bp gerAAR MW3 5′- TCGGCAGCATGCCTTGA -3′ RT-PCR (E = 2.01) 59 bp gerAAF 1112/1032/800 5′- CGCCGTTCCCACAGATTC {Selleck Anti-infection Compound Library|Selleck Antiinfection Compound Library|Selleck Anti-infection Compound Library|Selleck Antiinfection Compound Library|Selleckchem Anti-infection Compound Library|Selleckchem Antiinfection Compound Library|Selleckchem Anti-infection Compound Library|Selleckchem Antiinfection Compound Library|Anti-infection Compound Library|Antiinfection Compound Library|Anti-infection Compound Library|Antiinfection Compound Library|Anti-infection Compound Library|Antiinfection Compound Library|Anti-infection Compound Library|Antiinfection Compound Library|Anti-infection Compound Library|Antiinfection Compound Library|Anti-infection Compound Library|Antiinfection Compound Library|Anti-infection Compound Library|Antiinfection Compound Library|Anti-infection Compound Library|Antiinfection Compound Library|Anti-infection Compound Library|Antiinfection Compound Library|buy Anti-infection Compound Library|Anti-infection Compound Library ic50|Anti-infection Compound Library price|Anti-infection Compound Library cost|Anti-infection Compound Library solubility dmso|Anti-infection Compound Library purchase|Anti-infection Compound Library manufacturer|Anti-infection Compound Library research buy|Anti-infection Compound Library order|Anti-infection Compound Library mouse|Anti-infection Compound Library chemical structure|Anti-infection Compound Library mw|Anti-infection Compound Library molecular weight|Anti-infection Compound Library datasheet|Anti-infection Compound Library supplier|Anti-infection Compound Library in vitro|Anti-infection Compound Library cell line|Anti-infection Compound Library concentration|Anti-infection Compound Library nmr|Anti-infection Compound Library in vivo|Anti-infection Compound Library clinical trial|Anti-infection Compound Library cell assay|Anti-infection Compound Library screening|Anti-infection Compound Library high throughput|buy Antiinfection Compound Library|Antiinfection Compound Library ic50|Antiinfection Compound Library price|Antiinfection Compound Library cost|Antiinfection Compound Library solubility dmso|Antiinfection Compound Library purchase|Antiinfection Compound Library manufacturer|Antiinfection Compound Library research buy|Antiinfection Compound Library order|Antiinfection Compound Library chemical structure|Antiinfection Compound Library datasheet|Antiinfection Compound Library supplier|Antiinfection Compound Library in vitro|Antiinfection Compound Library cell line|Antiinfection Compound Library concentration|Antiinfection Compound Library clinical trial|Antiinfection Compound Library cell assay|Antiinfection Compound Library screening|Antiinfection Compound Library high throughput|Anti-infection Compound high throughput screening| –3′ RT-PCR (E = 2.01/1.98/1.95) 55 bp gerAAR 1112/1032/800 5′- CAGCGCTGAAGAAACCTTGTC –3′ RT-PCR (E = 2.01/1.98/1.95) 55 bp rpoBF 5′- ACCTCTTCTTATCAGTGGTTTCTTGAT -3′ RT-PCR (E = 2.00) 70 bp rpoBR 5′- CCTCAATTGGCGATATGTCTTG -3′ RT-PCR (E

= 2.00) 70 bp Data analysis The Staden Package [52] was used for alignment, editing and construction of consensus sequences based on the ABI sequence chromatograms. Consensus sequences (626 bp) were entered into the MEGA5 software [53] and aligned by CLUSTALW [54]. Dendograms were constructed in MEGA5 using the Neighbor-Joining method (NJ) [55] with branch lengths estimated by the Maximum Composite Likelihood method [56]. Branch quality was assessed by the bootstrap test using 500 replicates. Sequences were ifoxetine trimmed to be in frame, which means that eight bases in the transition between gerAB and gerAC were removed, before entering into S.T.A.R.T. 2 [57]. This program was used to calculate the dN/dS ratio (ratio of nonsynomous versus synonymous substitutions) [58]. The B. licheniformis gerA promoter sequence was identified in DBTBS [59] and prediction of transmembrane α-helices of GerAA and AB was performed using TOPCONS web program [60]. Finally, three-dimensional (3D) structure modeling of GerAC was performed using RaptorX and PyMOL [61, 62].